Upregulation là gì

Department of Cellular & Integrative christmasloaded.com, University of Nebraska Medical Center, Omaha, Nebraska


Department of Cellular & Integrative sầu christmasloaded.com, University of Nebraska Medical Center, Omaha, Nebraska


Department of Cellular và Integrative sầu christmasloaded.com, University of Nebraska Medical Center, Omaha, Nebraska


Address for reprint requests and other correspondence: I. H. Zucker, Dept. of Cellular và Integrative christmasloaded.com, 985850 Nebraska Medical Center, Omaha, NE 68198-5850 (e-mail: ).

Bạn đang xem: Upregulation là gì

Search for more papers by this author


It has been clearly established that increased circulating angiotensin II (ANG II) with concurrent upregulation of brain và peripheral ANG II type 1 receptors (AT1R) are important mediators in the pathochristmasloaded.com of several diseases characterized by sympatho-excitation. In an effort khổng lồ further underst& the regulation of AT1R expression in neurons, we determined the role of sequential activation of the transcription factors nuclear factor-κB (NF-κB) và Ets-like protein 1 (Elk-1) in AT1R upregulation. We used CATH.a neurons as our neuronal cell Mã Sản Phẩm. Cells were treated with ANG II (100 nM) over a prephối time course. Following ANG II activation, there was a temporal increase in the p65 subunit of NF-κB that was observed at 30 min, peaked at 1 h, & was sustained up to 24 h. There was a concomitant decrease of IκB & increased IκK expression. We also observed an increase in AT1R expression which followed the temporal increase of NF-κB. The activation of NF-κB was blocked by using the inhibitors parthenolide or p65 small interfering RNA (siRNA) which both led to lớn a decrease in AT1R expression. The expression of Elk-1 was upregulated over a time period following ANG II activation & was decreased following NF-κB inhibition. p65-DNA binding was assessed using electrophoretic mobility shift assay, & it was shown that there was a time-dependent increased binding that was inhibited by means of parthenolide pretreatment or siRNA-mediated p65 gen silencing. Therefore, our results suggest a combined role for the transcription factors NF-κB và Elk-1 in the upregulation of AT1R in the CATH.a cell neuronal Mã Sản Phẩm. These data imply a positive feedbachồng mechanism that may impact neuronal discharge sensitivity in response khổng lồ ANG II.


many cardiovascular disease states are characterized by an excess in sympathetic outflow. The central origin of sympatho-excitation is mediated, in part, by stimulation of neuronal angiotensin II (ANG II) type 1 (AT1) receptors (AT1R) in addition khổng lồ high levels of central ANG II peptide (33). This occurs in disease states such as hypertension & heart failure (9). While the peripheral renin-angiotensin system (RAS) may contribute khổng lồ sympathetic activation, there also exists an independent brain RAS containing all components necessary khổng lồ make this peptide (14). In the brain, AT1R is widely distributed in sympatho-regulatory nuclei including the medulla, hypothalamus, and the organum vasculosum of the lamimãng cầu terminalis (15, 32), & the arterial pressure và sympathetic nerve responses lớn intracerebroventricular infusion of ANG II are attenuated by the AT1 receptor blocker losartan (2).

ANG II is known to act via a wide spectrum of signaling pathways & activate transcription factors such as NF-κB (16), activator protein 1 (AP-1) (1), & Elk-1 (4) aước ao others. In previous studies we have sầu shown that upregulation of the AT1R in the brain of animals with chronic heart failure is dependent on the activation of AP-1, c-Jun, and Jun NH2-terminal kinase (JNK) (20). NF-κB is activated by a great variety of stimuli, including inflammatory cytokines, oxidative sầu bít tất tay, ultraviolet và ionizing radiation, & genotoxic drugs (12, 23).

NF-κB & AP-1 together orchestrate the expression of many genes concerned with numerous clinical conditions including heart failure (3). The regulation of c-fos, a component of AP-1, is controlled by the transcription factor Elk-1 (30). Elk-1 plays an important role in a variety of processes including cell cycle progression, differentiation, và apoptosis. The mechanism by which Elk-1 regulates transcription of genes is still not fully understood. NF-κB & AP-1 appear to be activated via different signaling pathways, but they nói qua numerous common stimuli, and the activation of many genes by AP-1 requires simultaneous nuclear translocation of NF-κB. It is therefore possible that Elk-1 forms the liên kết between NF-κB và AP-1 in the mechanism of gene transcription. Because both NF-κB & AP-1 have sầu been shown khổng lồ be involved in the transcriptional regulation of the AT1R in sympathetic neurons, it is important to lớn understand how these transcription factors are coordinated in the regulation of the AT1R in neurons. In the present study, we used a neuronal cell line, CATH.a neurons (a hybridoma derived from mouse locus coeruleus). This catecholaminergic cell line expresses AT1R và AT2R and has been shown to lớn upregulate AT1R following ANG II stimulation (18).


Cell culture.

CATH.a neurons were purchased from American Type Culture Collection (Manassas, VA). The cells were grown in RPXiaoMi MI 1640 truyền thông containing 8% horse serum, 4% fetal bovine serum, & 100 IU/l penicillin, at 37°C in 5% CO2 in a humidified atmosphere. The cells were plated at a mật độ trùng lặp từ khóa of 1 × 107 cells/100-milimet plate or 1.5 × 106 cells/well in six-well culture plates. All experiments were performed when the cultures were 70–80% confluent. Before treatment, the cells were allowed lớn differentiate in serum-miễn phí truyền thông media for 48–72 h. The cells were treated with ANG II (100 nM) alone or subsequent to lớn treatment with parthenolide (NF-κB inhibitor) (Sigma-Aldrich, St. Louis, MO) at a concentration of 10 μM. Parthenolide inhibits the nuclear translocation of p65 by preventing the phosphorylation of IκB by IκK. Following treatment, the cells were incubated over a stipulated time course (0–24 h), and at a defined time point, the cells were scraped off the culture plate & suspended in ice-cold phosphate-buffered saline (PBS). After centrifugation, the cell pellets were lysed with 50 μl of cold RIPA buffer (Santa Cruz) followed by sonication, & the lysates were further cleared by centrifugation at 12,000 rpm for đôi mươi min. The lysates were stored at −70°C.


Western blot analysis.

Cell lysates were assayed for protein concentration using a bicinchoninic acid protein kit (Pierce, Rockford, IL). Equal amounts of protein lysates (30 μg/well) were loaded on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis and separated. The proteins were transferred onkhổng lồ nitrocelluthua membranes at 100 V for 1.5 h. The membranes were blocked for 1 h at room temperature in 5% nonfat milk in Tris-buffered saline with Tween đôi mươi. The membranes were incubated with primary antibodies (1:500) against p65, IκK, IκB-α (Cell Signaling Technology), GAPDH, AT1R, Elk-1, và pElk-1 (Santa Cruz) overnight at 4°C. After being washed, the membranes were incubated with species-specific secondary antitoàn thân (1:1,000–1:2,000) for 1 h at room temperature. Visualization of the bands was done after incubation with Supersignal West Pico Chemiluminescent Detection reagents (Pierce). The bands were digitized & analyzed using UVPhường BioImaging Systems (UVPhường., Uplvà, CA). GAPDH was used to lớn ensure equal loading & for normalization.


Immunofluorescence microscopy.

CATH.a neurons were grown khổng lồ 50–60% confluence in two-well chamber slides. After appropriate treatment and incubation with ANG II, the truyền thông were aspirated & the cells were washed with ice-cold PBS. The cells were fixed with 100% methanol at −20°C for 10 min. The cells were then permeabilized in acetone at −20°C for 2 min. The cells were washed five times with PBS at room temperature. The cells were blocked using 10% horse serum, 1% bovine serum albumin (BSA) in PBS, for 1 h at room temperature. Primary antibody directed against p65 (Cell Signaling Technology) was diluted in 1% BSA (1:100) & applied lớn the cells & incubated at 4°C overnight. After being washed with PBS, the cells were incubated with anti-rabbit fluorescence-labeled secondary antibody in 1% BSA for 1 h at room temperature in the dark. The slides were mounted with coverslips using Fluoromount (Sigma-Aldrich). Fluorescence examination of at least five sầu to lớn six fields on the same slide was performed under an oil immersion objective (×60, 1.4 numerical aperture) using a Nikon Eclipse 800 fluorescent microscope. At each time point a representative group of cells were assessed for the extent of nuclear translocation. As a negative sầu control, we stained the cells either with primary or with secondary anti-antibody alone khổng lồ determine the specifithành phố of the fluorescence signal.


RT-PCR.

Total RNA was isolated from CATH.a neurons after appropriate treatment using the RNeasy (Qiagene, Valencia, CA) RNA isolation kit as per manufacturer"s guidelines. For each RT-PCR reaction, 1 μg of total RNA was used, and the purity of the RNA was determined by the ratio of optical density readings at 260 nm and 280 nm. The RNA used for RT-PCR had a ratio of 1.8–2.0. RT-PCR was carried out in a programmable thermal controller (PTC-100, Bio-Rad) with the following oligonucleotide primers: p65 forward, TGGACAGAACAGCAGGATGTGTGA; p65 reverse, AGCTGTCCGAGAAGTTCGGCATAA; GAPDH forward, GATGCTGGTGCTGAGTATGTCGT, and GAPDH reverse, TTGTCATTGAGAGCAATGCCAGCC.

cDNA synthesis was performed using iSCRIPT (Bio-Rad) kit with the following parameters: 5 min at 25°C, 30 min at 42°C, & 5 min at 85°C. For amplification of the DNA template, PCR Mastermix (Promega, Madison, WI) was used as per the manufacturer"s guidelines using the specific primer pairs shown above sầu. The reaction was carried out in a PTC-100 thermal cycler, using the following parameters: 95°C for 5 min, 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min; steps 2, 3, và 4 were repeated for 25–30 cycles followed by 10 min of incubation at 72°C và held at 4°C until gel electrophoresis và visualization. PCR products were separated by electrophoresis through an agarose gel (1.5%) và visualized by ethidium bromide staining. The bands were analyzed using UVP BioImaging Systems. GAPDH was used for normalization.


Electrophoresis mobility gel shift assay.

Electrophoresis mobility gel shift assay (EMSA) was performed as described earlier (20). Briefly, cells were washed with PBS and lysed with cytoplasmic extraction buffer <10 mM Tris·HCl (pH 7.9), 60 mM KCl, 1 mM EDTA, 0.4% Igepal CA-630, 1 mM dl-dithiothreitol, 10 μg/ml leupeptin, 0.1 KU/ml aprotinin, & 0.1 mg/ml phenylmethylsulfonyl fluoride> on ice. The lysate was centrifuged at 2,500 rpm for 4 min at 4°C. The pellet was resuspended in cytoplasmic extraction buffer & centrifuged and the supernatant was removed. Nuclear extraction buffer (50 mM Tris·HCl, 1.5 mM MgCl2, 4trăng tròn mM NaCl, 25% glycerol, 10 μg/ml leupeptin, và 100 kallikrein inhibitory units/ml) was added lớn the pellet & vortexed for 1 min. After 10 min on ice, the mixture was centrifuged for 10 min at 4°C & the supernatant (nuclear extract) was collected and stored at −70°C.

EMSA was performed using Gel Shift Assay System (Promega) as per the manufacturer"s instructions. In brief, 5 μg of nuclear lysate was incubated with oligonucleotide probe with binding buffer <4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM dithiothreitol, 50 mM NaCl, 10 mM Tris·HCl, pH 7.5, và 50 μg/ml poly(dI-dC)> at room temperature for trăng tròn min. The probes were purchased from Santa Cruz Biocông nghệ. A nonspecific mutant probe was used lớn eliminate nonspecific binding. After incubation, the DNA-protein complex was resolved on 4% nondenaturing polyacrylamide gel at 150 V. The gels were stained with SYBR green using a commercially available kit (Molecular Probes) & visualized quantified using UVP.. BioImaging Systems. This procedure is igiảm giá for nonisotopic EMSA applications. Probe sequences for the NF-κB probes were as follows: for NF-κB (consensus oligo), 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; for NF-κB (mutant oligo), 5′-AGT TGA GGG GAC TTT CCC AGG C-3′. The mutant oligonucleotide was used to lớn determine the specifiđô thị of the p65-DNA binding on the consensus binding motif (GGG GAC TTT GCC).


siRNA-mediated gen silencing in vitro.

Xem thêm: Tra Từ Single Point Of Failure Là Gì, Định Nghĩa Và Giải Thích Ý Nghĩa

Gene silencing was used khổng lồ inhibit the expression of NF-κB gen in CATH.a neurons. The ON-TARGET plus (Thermo Scientific) siRNA sequence was 5′-TCTGCCCTCCTGACTCTACTC-3′ (antisense). For Elk-1 gene silencing, siRNA sequence 5′-AACCACCCGCCACTCTTCCT-3′ (antisense) were used. The protocol was as per manufacturer"s instructions. The siRNA was used at a final concentration of 0.1–0.5 μM. Transfection was done using siPORT amine (Ambion, Austin, TX) diluted in Opti-MEM 1 serum-không tính tiền medium. The controls were treated with vehicle without the siRNA oligos. The culture plates were assayed for target gene activity 24–48 h after transfection by RT-PCR và Western blotting.


Statistical analysis.

The data are expressed as means ± SE and were analyzed using one-way ANOVA with Tukey"s post kiểm tra analysis for comparison of intra- as well as intergroup variance. Statistical significance was assumed when P RESULTS

Activation of NF-κB.

NF-κB activation following ANG II stimulation was examined by Western blot for the expression levels of p65, IκK, and IκBα. Treatment with ANG II (100 nM) induced p65 activation in CATH.a neurons over an extended time course period. Expression of p65 was significantly increased beginning at 30 min, reaching a plateau at 1 h, và then falling baông chồng toward baseline at 24 h (Fig. 1A). There was a concurrent rise in IκK activation beginning at 30 min which remained significantly elevated over the 24-h time course (Fig. 1B). This was expected in view of the persistent NF-κB activity over the same time period. IκBα, the inhibitory protein of NF-κB, was decreased as a result of continued IκK activity và its subsequent proteosomal degradation (Fig. 1C). We examined the direct effect of ANG II activation via the AT1R on p65 activation. As expected, ANG II increased p65 gene expression và protein (Fig. 1, D và E). AT1R blockade with losartung reduced the response to ANG II following 8 h of incubation.

Fig. 1.Effect of angiotensin II (ANG II) stimulation on NF-κB expression. A–C: Western blot of CATH.a cell lysates showing the protein expression of p65 (A), IκK (B), & IκB-α (C) following stimulation with ANG II (100 nM) over the specified time course (n = 5, *P D and E: CATH.a cells were pretreated with losartung (Los; 1 μM) for 30 min followed by ANG II (100 nM) activation for a period of 8 h. RNA & protein were harvested, và RT-PCR and Western blotting were performed for p65 transcript (D) and protein (E). AU, arbitrary units. (n = 3, *Phường

Inhibition of NF-κB.

To examine whether inhibition of NF-κB would have sầu an effect on its downstream targets, namely, AT1R and Elk-1, we used the pharmacological agent parthenolide and an siRNA directed against p65. Immunofluorescence studies of CATH.a neurons showed that, in the resting state, NF-κB protein was localized primarily to lớn the cytosol. When stimulated with ANG II, NF-κB exhibited a translocation of the p65 subunit inkhổng lồ the nucleus beginning at 1 h & was reduced at 8 h (Fig. 2A, top). Pretreatment of the cells with parthenolide (10 μM) inhibited the phosphorylation of IκB and subsequent activation of NF-κB. As a result, there was no translocation of the p65 molecule into the nucleus as shown by immunofluorescence (Fig. 2A, bottom). A more direct gene silencing technique using p65-directed siRNA corroborated the parthenolide data. Following gene silencing, the cells were treated with ANG II (100 nM) over an 8-h period. RT-PCR using p65-specific primers showed a 70% silencing of the p65 ren as shown by p65 mRNA (Fig. 2B).

Fig. 2.Effect of NF-κB inhibition using parthenolide and p65 small interfering RNA (siRNA). A, top: immunofluorescence following ANG II (100 nM). Bottom: parthenolide (10 μM) treatment shows inhibition of nuclear localization. B: RT-PCR following gene silencing using p65-siRNA followed by stimulation with ANG II (100 nM). OD, optical density. (Mean of 5 replications done in duplicate; *P.

Effect of p65 inhibition on AT1R expression.

To determine the downstream effects of p65 following ANG II stimulation, we examined the expression of AT1R with và without p65 inhibition. ANG II (100 nM) evoked an increase in AT1R expression which was significant at 4 h & remained so up to lớn 24 h (Fig. 3A). Gene silencing of the p65 subunit using anti-p65 siRNA caused a marked decrease (50–75%) of AT1R over an 8-h period (Fig. 3B). Similarly, the IκK inhibitor parthenolide (10 μM) caused a decrease in AT1R expression which was significant at 8 & 24 h (Fig. 3C).

Fig. 3.Effect of p65 inhibition on ANG II type 1 receptor (AT1R) expression. A–C: Western blot of CATH.a cell lysates showing protein expression following stimulation with ANG II (100 nM) over the specified time course (A), following p65 gen silencing using siRNA (B), & following treatment with parthenolide (10 μM) (C). (n = 5, *Phường.

Effect of ANG II on Elk-1.

CATH.a neurons were stimulated with ANG II (100 nM) over a 24-h time period. Western blotting was done for expression of both Elk-1 & phosphorylated Elk-1. Following ANG II stimulation, the expression of Elk-1 protein was significantly increased at 8 & 24 h (Fig. 4A), & the phosphorylated form was elevated at 1 h & remained at elevated levels for the duration of the 24-h time course (Fig. 4B). To examine the role of NF-κB on Elk-1 activation, p65 siRNA-mediated ren silencing followed by ANG II activation evoked a decrease in Elk-1 protein expression (Fig. 4C), thus confirming that p65 is required for Elk-1 protein activation.

Fig. 4.Effect of ANG II activation on Ets-lượt thích protein 1 (Elk-1) expression. A–C: Western blot of CATH.a cell lysates showing the expression of Elk-1 following stimulation with ANG II (100 nM) (A), phosphorylated Elk-1 following ANG II (100 nM) (B), and Elk-1 expression following p65 gen silencing using anti-p65siRNA (C). (n = 5, *Phường.

Effect of ANG II, parthenolide, & p65siRNA on NF-κB-DNA binding.

To examine the constitutive và ANG II-dependent binding of NF-κB to lớn DNA, we stimulated CATH.a neurons with ANG II & performed an EMSA after 1 h of stimulation. ANG II evoked a clear increase in binding of the p65 subunit with DNA (Fig. 5). To eliminate nonspecific binding, reactions were performed 1) without any nuclear extract, 2) using a mutant p65 probe, và 3) as a positive sầu control, using nuclear lysates of cells treated with TNF-α (10 ng/ml), a proinflammatory cytokine known to activate NF-κB (Fig. 5A). Treatment of the cells with ANG II following either p65 siRNA-mediated gen silencing or parthenolide pretreatment showed decreased protein-DNA binding (Fig. 5B). The EMSA results demonstrated that there was persistent protein-DNA interaction at 1, 8, & 24 h (Fig. 5C). This supports the Western blot data indicating persistent NF-κB activity over the same time course.

Fig. 5.

Xem thêm: Tại Sao Gọi Là Màu Hường Là Màu Gì, ____ Màu Hường Và Những Khía Cạnh Khoa

NF-κB-DNA binding. A: binding reactions under different treatment conditions. Lanes are as follows: 1, no nuclear extract; 2, ANG II + mutant p65 probe; 3, ANG II + p65 probe; 4, nuclear extract of cells treated with TNF-α (positive control). B: effect of DNA-protein interaction following NF-κB inhibition. Lanes are as follows: 1, ANG II + p65 probe; 2, nuclear extract of cells treated with TNF-α (positive control); 3, ANG II + p65 mutant probe; 4, ANG II + siRNA-treated cells; 5, ANG II + parthenolide-treated cells. C: time-dependent NF-κB-DNA binding over a specified time course following activation with ANG II (100 nM). (n = 5, *P.



GRANTS

This work was supported by National Heart, Lung, and Blood Institute Grant PO-1 62222.


Chuyên mục: Hỏi Đáp